The detailed information of tRNA gene sequence


Sequence ID>W1710821930
Genome IDLKUC01000050
Search identical group
Phylum/ClassBetaproteobacteria
SpeciesSmithella sp. SDB (LKUC)
Start position on genome 4773
End posion on genome 4847
Amino Acid Val
Anticodon CAC
Upstream region at tRNA start position
atcttcactc
tRNA gene sequence
GGGCGGTTAACTCAGCGGGAGAGTGCTACCTTCACACGGTAGAAGTCACTGGTTCAAATC
CAGTACCGCCTACCA
Downstream region at tRNA end position
tttattgtga
Secondary structure (Cloverleaf model)
>W1710821930	Val	CAC
                   c      ACCA tttattgtga
                     G + T
                     G - C
                     G - C
                     C - G
                     G - C
                     G - C
                     T - A          T A
                    T     T G A C C     A
        G A        A      | | | | |     A
      C     C T C A       A C T G G     C
      G     | | | |                 T T
      G     G A G T
        G A        G     AAGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    C - G
                  T       C
                  T       A
                    C A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK