The detailed information of tRNA gene sequence


Sequence ID>W1710822015
Genome IDLKUH01000087
Search identical group
Phylum/ClassCloacimonetes
SpeciesCandidatus Cloacimonas sp. SDB (LKUH)
Start position on genome 1026
End posion on genome 1100
Amino Acid Asn
Anticodon GTT
Upstream region at tRNA start position
tgatgattaa
tRNA gene sequence
TCCTGAATAGCTCAGCGGTAGAGCGGGTGGCTGTTAACCACTAGGTCGGGGGTTCAAATC
CCTCTTCAGGAGCCA
Downstream region at tRNA end position
taataaagcc
Secondary structure (Cloverleaf model)
>W1710822015	Asn	GTT
                   a      GCCA taataaagcc
                     T - A
                     C - G
                     C - G
                     T - A
                     G - C
                     A - T
                     A - T          T A
                    T     C T C C C     A
        G A        A      | + | | |     A
      C     C T C G       G G G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        G     AGGTC
                    G + T
                    G - C
                    T - A
                    G - C
                    G - C
                  C       A
                  T       A
                    G T T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK