The detailed information of tRNA gene sequence


Sequence ID>W1710853415
Genome IDLLWQ01000175
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus sp. MKU1 (LLWQ)
Start position on genome 21804
End posion on genome 21719
Amino Acid Leu
Anticodon TAA
Upstream region at tRNA start position
aattcccggc
tRNA gene sequence
GCGGGCGTGGCGGAATGGTAGACGCATGGGACTTAAACTCCCTGGGGCGCAAGCCTGTGC
GGGTTCGAGTCCCGCCGCCCGCACCA
Downstream region at tRNA end position
tgcccggcga
Secondary structure (Cloverleaf model)
>W1710853415	Leu	TAA
                   c      ACCA tgcccggcga
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C          T G
                    T     C G C C C     A
      T A A        G      | | | | |     G
    G       G G C G       G C G G G     C
    G         | | |                 T T
    T       A C G C
      A G          A     GGGGCGCAAGCCTGT
                    T   T
                    G - C
                    G - C
                    G - C
                    A - T
                  C       C
                  T       A
                    T A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK