The detailed information of tRNA gene sequence


Sequence ID>W1710853421
Genome IDLLWQ01000202
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus sp. MKU1 (LLWQ)
Start position on genome 57299
End posion on genome 57382
Amino Acid Leu
Anticodon CAA
Upstream region at tRNA start position
acgcagaaag
tRNA gene sequence
GCCCGAGTGGCGGAATGGTAGACGCAGCGGATTCAAAATCCGCCGCCGCAAGGCATGTCG
GTTCGAGTCCGACCTCGGGTACCA
Downstream region at tRNA end position
attgaagcat
Secondary structure (Cloverleaf model)
>W1710853421	Leu	CAA
                   g      ACCA attgaagcat
                     G + T
                     C - G
                     C - G
                     C - G
                     G - C
                     A - T
                     G - C          T G
                    T     C A G C C     A
      T A A        G      | | | | |     G
    G       G G C G       G T C G G     C
    G         | | |                 T T
    T       A C G C
      A G          A     CGCCGCAAGGCAT
                    G - C
                    C - G
                    G - C
                    G - C
                    A - T
                  T       A
                  T       A
                    C A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK