The detailed information of tRNA gene sequence


Sequence ID>W1710864706
Genome IDLMGC01000004
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesEnsifer sp. Root558 (LMGC)
Start position on genome 164918
End posion on genome 165014
Amino Acid SeC(p)
Anticodon TCA
Upstream region at tRNA start position
tcagcgctgA
tRNA gene sequence
GGAAGGGAATCGTCTCCGGTGGGACGGCCGGACTTCAAATCCGGTTGGGGCAGCGAGCCT
GTCCCGGGTGGGTTCGACCCCCACTCCCCTCCGCC
Downstream region at tRNA end position
Agcgctcacg
Secondary structure (Cloverleaf model)
>W1710864706	SeC(p)	TCA
                   A      CGCC Agcgctcacg
                     G - C
                     G + T
                     A   C
                     A   C
                     G - C
                     G - C
                     G + T          C C
                    A     C A C C C     A
      C T C        A      | | | | |     G
    C       T G C T       G T G G G     C
    G       +     +                 T T
    G       G A C G
      T G G        G     TTGGGGCAGCGAGCCTGTCCCGG
                    C - G
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK