The detailed information of tRNA gene sequence


Sequence ID>W1710865794
Genome IDLMGY01000016
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesPseudoxanthomonas sp. Root630 (LMGY)
Start position on genome 376965
End posion on genome 377041
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
ccgccgtctt
tRNA gene sequence
GGCCCCGTAGCTCAGCTGGATAGAGCGTCCCCCTCCTAAGGGGAAGGTCGCACGTTCGAA
TCGTGTCGGGGCCGCCA
Downstream region at tRNA end position
tctcctctcc
Secondary structure (Cloverleaf model)
>W1710865794	Arg	CCT
                   t      GCCA tctcctctcc
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     T G T G C     A
      C G A        A      + | | | |     G
    T       C T C G       G C A C G     C
    G       | | | |                 T T
    G       G A G C
      A T A        G     AGGTC
                    T - A
                    C - G
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK