The detailed information of tRNA gene sequence


Sequence ID>W1710869723
Genome IDLMJY01000012
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesNovosphingobium sp. Leaf2 (LMJY)
Start position on genome 264813
End posion on genome 264889
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
ggtccgatat
tRNA gene sequence
GGCGGAGTAGCTCAGTCGGTTAGAGCAGCGGAATCATAATCCGCGTGTCGGGGGTTCGAG
TCCCTCCTCCGCTACCA
Downstream region at tRNA end position
ttcttccccc
Secondary structure (Cloverleaf model)
>W1710869723	Met	CAT
                   t      ACCA ttcttccccc
                     G + T
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     G - C          T G
                    T     C T C C C     A
      T G A        A      | + | | |     G
    C       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        A     GTGTC
                    G - C
                    C - G
                    G - C
                    G - C
                    A - T
                  A       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK