The detailed information of tRNA gene sequence


Sequence ID>W1710870090
Genome IDLMKG01000001
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesSphingomonas sp. Leaf11 (LMKG)
Start position on genome 45930
End posion on genome 46006
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gcgtgcgcgt
tRNA gene sequence
GGCCTCGTAGCTCAGCTGGACAGAGCGCCGCTTTCCTAAAGCGGGCGTCGGGGGTTCGAG
TCCCTCCGAGGCCACCA
Downstream region at tRNA end position
gtttcccgaa
Secondary structure (Cloverleaf model)
>W1710870090	Arg	CCT
                   t      ACCA gtttcccgaa
                     G - C
                     G - C
                     C - G
                     C - G
                     T - A
                     C - G
                     G - C          T G
                    T     C T C C C     A
      C G A        A      | + | | |     G
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      A C A        G     GCGTC
                    C - G
                    C - G
                    G - C
                    C - G
                    T - A
                  T       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK