The detailed information of tRNA gene sequence


Sequence ID>W1710871016
Genome IDLMKY01000014
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesSphingomonas sp. Leaf29 (LMKY)
Start position on genome 56067
End posion on genome 56143
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gcggcgccat
tRNA gene sequence
GGCCTCGTAGCTCAGCTGGACAGAGCGCCGCTTTCCTAAAGCGGGCGTCGGGGGTTCGAG
TCCCTCCGAGGCCACCA
Downstream region at tRNA end position
gttttccgcc
Secondary structure (Cloverleaf model)
>W1710871016	Arg	CCT
                   t      ACCA gttttccgcc
                     G - C
                     G - C
                     C - G
                     C - G
                     T - A
                     C - G
                     G - C          T G
                    T     C T C C C     A
      C G A        A      | + | | |     G
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      A C A        G     GCGTC
                    C - G
                    C - G
                    G - C
                    C - G
                    T - A
                  T       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK