The detailed information of tRNA gene sequence


Sequence ID>W1710871052
Genome IDLMKZ01000018
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesSphingomonas sp. Leaf30 (LMKZ)
Start position on genome 811610
End posion on genome 811686
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
tcacgtgcgt
tRNA gene sequence
GGCCCCGTAGCTCAGCCGGATAGAGCACCAGATTCCTAATCTGGGGGCCAGTGGTTCAAA
TCCACTCGGGGTCACCA
Downstream region at tRNA end position
ccaccaccga
Secondary structure (Cloverleaf model)
>W1710871052	Arg	CCT
                   t      ACCA ccaccaccga
                     G - C
                     G + T
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     T C A C C     A
      C G A        A      | | | | |     A
    C       C T C G       A G T G G     C
    G       | | | |                 T T
    G       G A G C
      A T A        A     GGGCC
                    C - G
                    C - G
                    A - T
                    G - C
                    A - T
                  T       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK