The detailed information of tRNA gene sequence


Sequence ID>W1710871199
Genome IDLMLC01000004
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesSphingomonas sp. Leaf34 (LMLC)
Start position on genome 63242
End posion on genome 63166
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gcgacccgat
tRNA gene sequence
GCCCCCGTAGCTCAGCCGGATAGAGCGACGGTTTCCTAAACCGTAGGCCGCGTGTTCAAA
TCTCGCCGGGGGCACCA
Downstream region at tRNA end position
gcttctaccg
Secondary structure (Cloverleaf model)
>W1710871199	Arg	CCT
                   t      ACCA gcttctaccg
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C G C T C     A
      C G A        A      | | |   |     A
    C       C T C G       G C G T G     C
    G       | | | |                 T T
    G       G A G C
      A T A        G     AGGCC
                    A - T
                    C - G
                    G - C
                    G - C
                    T - A
                  T       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK