The detailed information of tRNA gene sequence


Sequence ID>W1710871627
Genome IDLMLK01000023
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesErwinia sp. Leaf53 (LMLK)
Start position on genome 319623
End posion on genome 319549
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gcccgccgct
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
tatcgacatc
Secondary structure (Cloverleaf model)
>W1710871627	Arg	CCT
                   t      ACCA tatcgacatc
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK