The detailed information of tRNA gene sequence


Sequence ID>W1710871859
Genome IDLMLN01000028
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesSphingomonas sp. Leaf62 (LMLN)
Start position on genome 499319
End posion on genome 499243
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gcgcgtcgat
tRNA gene sequence
GGCCTCGTAGCTCAGCTGGACAGAGCGCCGCTTTCCTAAAGCGGGCGTCGGGGGTTCGAG
TCCCTCCGAGGCCACCA
Downstream region at tRNA end position
gtcatcgtcc
Secondary structure (Cloverleaf model)
>W1710871859	Arg	CCT
                   t      ACCA gtcatcgtcc
                     G - C
                     G - C
                     C - G
                     C - G
                     T - A
                     C - G
                     G - C          T G
                    T     C T C C C     A
      C G A        A      | + | | |     G
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      A C A        G     GCGTC
                    C - G
                    C - G
                    G - C
                    C - G
                    T - A
                  T       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK