The detailed information of tRNA gene sequence


Sequence ID>W1710872285
Genome IDLMLW01000001
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesSphingomonas sp. Leaf242 (LMLW)
Start position on genome 595208
End posion on genome 595132
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gcacccggat
tRNA gene sequence
GCCCCCGTAGCTCAGCCGGATAGAGCGACGGTTTCCTAAACCGTAGGCCGCGTGTTCAAA
TCTCGCCGGGGGCACCA
Downstream region at tRNA end position
gcttttccgc
Secondary structure (Cloverleaf model)
>W1710872285	Arg	CCT
                   t      ACCA gcttttccgc
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C G C T C     A
      C G A        A      | | |   |     A
    C       C T C G       G C G T G     C
    G       | | | |                 T T
    G       G A G C
      A T A        G     AGGCC
                    A - T
                    C - G
                    G - C
                    G - C
                    T - A
                  T       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK