The detailed information of tRNA gene sequence


Sequence ID>W1710877205
Genome IDLMPX01000001
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesSphingomonas sp. Leaf198 (LMPX)
Start position on genome 558086
End posion on genome 558010
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gcaaccggat
tRNA gene sequence
GCCCCCGTAGCTCAGCCGGATAGAGCGACGGTTTCCTAAACCGTAGGCCGCGTGTTCAAA
TCTCGCCGGGGGCACCA
Downstream region at tRNA end position
gcttttctgc
Secondary structure (Cloverleaf model)
>W1710877205	Arg	CCT
                   t      ACCA gcttttctgc
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C G C T C     A
      C G A        A      | | |   |     A
    C       C T C G       G C G T G     C
    G       | | | |                 T T
    G       G A G C
      A T A        G     AGGCC
                    A - T
                    C - G
                    G - C
                    G - C
                    T - A
                  T       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK