The detailed information of tRNA gene sequence


Sequence ID>W1710892801
Genome IDLNED01000014
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesSphingomonadales bacterium Ga0077531 (LNED)
Start position on genome 19713
End posion on genome 19637
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
aggcccatgg
tRNA gene sequence
GGCGGAGTAGCTCAGTCGGTTAGAGCAGCGGAATCATAATCCGCGTGTCGGGGGTTCGAG
TCCCTCCTCCGCTACCA
Downstream region at tRNA end position
tcttcgttgc
Secondary structure (Cloverleaf model)
>W1710892801	Met	CAT
                   g      ACCA tcttcgttgc
                     G + T
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     G - C          T G
                    T     C T C C C     A
      T G A        A      | + | | |     G
    C       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        A     GTGTC
                    G - C
                    C - G
                    G - C
                    G - C
                    A - T
                  A       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK