The detailed information of tRNA gene sequence


Sequence ID>W131157557
Genome IDAQSK01000195
Search identical group
Phylum/Classcandidate division KSB1
Speciescandidate division KSB1 bacterium SCGC AAA252-E13 [AQSK]
Start position on genome 43905
End posion on genome 43980
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
tgtcccacgt
tRNA gene sequence
GGGTGATTAACTCAGAGGCTAGAGTGCTTCCCTTACAAGGAAGAAGTCGTAGGTTCGAAT
CCTACATCGCCCACCA
Downstream region at tRNA end position
tttttttgtc
Secondary structure (Cloverleaf model)
>W131157557	Val	TAC
                   t      ACCA tttttttgtc
                     G - C
                     G - C
                     G - C
                     T + G
                     G - C
                     A - T
                     T - A          T A
                    T     C A T C C     A
      A G A        A      | | | | |     G
    G       C T C A       G T A G G     C
    G       | | | |                 T T
    C       G A G T
      T A          G     AAGTC
                    C - G
                    T - A
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    T A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK