The detailed information of tRNA gene sequence


Sequence ID>W131157616
Genome IDAQSM01000126
Search identical group
Phylum/Classcandidate division KSB1
Speciescandidate division KSB1 bacterium SCGC AAA252-N14 [AQSM]
Start position on genome 7533
End posion on genome 7606
Amino Acid Cys
Anticodon GCA
Upstream region at tRNA start position
cattttttcc
tRNA gene sequence
GGCGACATAGCCAAGTGGTAAGGCAGGGGTCTGCAAAATCCTTATCCCCGGTTCGAATCC
GGGTGTCGCCTCCA
Downstream region at tRNA end position
tatttttagc
Secondary structure (Cloverleaf model)
>W131157616	Cys	GCA
                   c      TCCA tatttttagc
                     G - C
                     G - C
                     C - G
                     G - C
                     A - T
                     C - G
                     A - T          T A
                    T     G G G C C     A
        G A        A      | | | | |     G
      T     A C C G       C C C G G     C
      G       | | |                 T T
      G     A G G C
        T A        A     TATC
                    G + T
                    G - C
                    G - C
                    G + T
                    T - A
                  C       A
                  T       A
                    G C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK