The detailed information of tRNA gene sequence


Sequence ID>W131157814
Genome IDAQSW01000054
Search identical group
Phylum/Classcandidate division OP9
Speciescandidate division OP9 bacterium SCGC AB-164-A22 [AQSW]
Start position on genome 4253
End posion on genome 4329
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
caaaatacgg
tRNA gene sequence
CGCGGGGTGGAGCAGTCAGGTAGCTCGTCAGGCTCATAACCTGAAGGTCGGTGGTTCGAA
TCCGCCCCCCGCAACCA
Downstream region at tRNA end position
atttttaaaa
Secondary structure (Cloverleaf model)
>W131157814	Met	CAT
                   g      ACCA atttttaaaa
                     C   A
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C C G C C     A
      T G A        G      | | + | |     G
    C       C G A G       G G T G G     C
    A       | | | |                 T T
    G       G C T C
      G T A        G     AGGTC
                    T - A
                    C - G
                    A - T
                    G - C
                    G - C
                  C       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK