The detailed information of tRNA gene sequence


Sequence ID>W131157820
Genome IDAQSW01000080
Search identical group
Phylum/Classcandidate division OP9
Speciescandidate division OP9 bacterium SCGC AB-164-A22 [AQSW]
Start position on genome 36284
End posion on genome 36210
Amino Acid Asn
Anticodon GTT
Upstream region at tRNA start position
atggtaatat
tRNA gene sequence
TCCTCGGTAGCTCAACGGTGGAGCATCCGGCTGTTAACCGGAGGGTTGTAGGTTCGAATC
CTACCCGGGGAGCCA
Downstream region at tRNA end position
gtttttagtt
Secondary structure (Cloverleaf model)
>W131157820	Asn	GTT
                   t      GCCA gtttttagtt
                     T - A
                     C - G
                     C - G
                     T + G
                     C - G
                     G - C
                     G - C          T A
                    T     C A T C C     A
        A A        A      | | | | |     G
      C     C T C G       G T A G G     C
      G     | | | |                 T T
      G     G A G C
        T G        A     GGGTT
                    T - A
                    C - G
                    C - G
                    G - C
                    G - C
                  C       A
                  T       A
                    G T T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK