The detailed information of tRNA gene sequence


Sequence ID>W131157824
Genome IDAQSW01000083
Search identical group
Phylum/Classcandidate division OP9
Speciescandidate division OP9 bacterium SCGC AB-164-A22 [AQSW]
Start position on genome 29560
End posion on genome 29637
Amino Acid His
Anticodon GTG
Upstream region at tRNA start position
ataaaatgtg
tRNA gene sequence
GTGGGCGTAGCTCAGCCTGGTTAGAGCCCTGGAATGTGGCTCCAGAGGTCGGGGGTTCAA
ATCCCCTCGCTCACCCCA
Downstream region at tRNA end position
gtttgccaat
Secondary structure (Cloverleaf model)
>W131157824	His	GTG
                   g      CCCA gtttgccaat
                     G - C
                     T - A
                     G - C
                     G + T
                     G - C
                     C - G
                     G - C          T A
                    T     T C C C C     A
    C C G A        A      + | | | |     A
  T         C T C G       G G G G G     C
  G         | | | |                 T T
  G         G A G C
    T T A          C     AGGTC
                    C - G
                    T - A
                    G - C
                    G - C
                    A - T
                  A       C
                  T       G
                    G T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK