The detailed information of tRNA gene sequence


Sequence ID>W131162459
Genome IDAQYX01000174
Search identical group
Phylum/Classcandidate division OP9
Speciescandidate division OP9 bacterium SCGC AAA252-M02 [AQYX]
Start position on genome 1671
End posion on genome 1744
Amino Acid Cys
Anticodon GCA
Upstream region at tRNA start position
aattcaatgt
tRNA gene sequence
GGCGGCATAGCCAAGTGGTAAGGCAGAGGACTGCAAATCCTTCATCCTCGGTTCGAATCC
GAGTGCCGCCTCCA
Downstream region at tRNA end position
tttagttttg
Secondary structure (Cloverleaf model)
>W131162459	Cys	GCA
                   t      TCCA tttagttttg
                     G - C
                     G - C
                     C - G
                     G - C
                     G - C
                     C - G
                     A - T          T A
                    T     G A G C C     A
        G A        A      | | | | |     G
      T     A C C G       C T C G G     C
      G       | | |                 T T
      G     A G G C
        T A        A     CATC
                    G + T
                    A - T
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    G C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK