The detailed information of tRNA gene sequence


Sequence ID>W1711136043
Genome IDLUZT01000001
Search identical group
Phylum/ClassChlorobi
SpeciesChlorobiales bacterium Clorobi_01 (LUZT)
Start position on genome 19961
End posion on genome 20034
Amino Acid Cys
Anticodon GCA
Upstream region at tRNA start position
gcttcacttt
tRNA gene sequence
GGTGAAGTGGCCGAGTGGCTAGGCAGAGGTCTGCAAAACCTCGTACAGCGGTTCGAATCC
GCTCTTCACCTCCA
Downstream region at tRNA end position
gataccttca
Secondary structure (Cloverleaf model)
>W1711136043	Cys	GCA
                   t      TCCA gataccttca
                     G - C
                     G - C
                     T - A
                     G - C
                     A - T
                     A - T
                     G - C          T A
                    T     T C G C C     A
        G A        G      | | | | |     G
      T     G C C G       A G C G G     C
      G       | | |                 T T
      G     A G G C
        C T        A     GTAC
                    G - C
                    A - T
                    G - C
                    G - C
                    T - A
                  C       A
                  T       A
                    G C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK