The detailed information of tRNA gene sequence


Sequence ID>W1711143839
Genome IDLVHS01000021
Search identical group
Phylum/ClassCyanobacteria
SpeciesProchlorococcus marinus str. MIT 1342 (LVHS)
Start position on genome 17894
End posion on genome 17813
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
agtcggccac
tRNA gene sequence
GCGGATGTGGTGGAATTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTCGGCCTTGCG
AGTTCAAGTCTCGCCATCCGCAttc
Downstream region at tRNA end position
tttccttaca
Secondary structure (Cloverleaf model)
>W1711143839	Leu	GAG
                   c      Attc tttccttaca
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     C G C T C     A
      T A A        G      | | | | |     A
    T       G G T G       G C G A G     C
    G         | | |                 T T
    G       A C A C
      T A G        G     TGGCTTCGGCCTT
                    C - G
                    A - T
                    C - G
                    G - C
                    T + G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK