The detailed information of tRNA gene sequence


Sequence ID>W1711143949
Genome IDLVHU01000009
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. MIT S9508 (LVHU)
Start position on genome 64213
End posion on genome 64132
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
aatcgaccac
tRNA gene sequence
GCGGATGTGGTGGAATTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTCGGCCTTGCG
AGTTCAAGTCTCGCCATCCGCAttt
Downstream region at tRNA end position
ctcttccaaa
Secondary structure (Cloverleaf model)
>W1711143949	Leu	GAG
                   c      Attt ctcttccaaa
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     C G C T C     A
      T A A        G      | | | | |     A
    T       G G T G       G C G A G     C
    G         | | |                 T T
    G       A C A C
      T A G        G     TGGCTTCGGCCTT
                    C - G
                    A - T
                    C - G
                    G - C
                    T + G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK