The detailed information of tRNA gene sequence


Sequence ID>W1711184189
Genome IDLWLR01000001
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesPantoea sp. OXWO6B1 (LWLR)
Start position on genome 3864079
End posion on genome 3864153
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
ctgcgctggc
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
aatgctagtc
Secondary structure (Cloverleaf model)
>W1711184189	Arg	CCT
                   c      ACCA aatgctagtc
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK