The detailed information of tRNA gene sequence


Sequence ID>W131192127
Genome IDASKN01000056
Search identical group
Phylum/Classcandidate division KSB1
Speciescandidate division KSB1 bacterium SCGC AAA252-F02 [ASKN]
Start position on genome 261
End posion on genome 335
Amino Acid Glu
Anticodon TTC
Upstream region at tRNA start position
atctttttga
tRNA gene sequence
GGCCCCATCGTCTAACGGTTAGGACTCAGGATTTTCATTCCTGCAATAGGGGTTCGATTC
CCCTTGGGGTCACCA
Downstream region at tRNA end position
tttgtggttt
Secondary structure (Cloverleaf model)
>W131192127	Glu	TTC
                   a      ACCA tttgtggttt
                     G - C
                     G + T
                     C - G
                     C - G
                     C - G
                     C - G
                     A - T          T T
                    T     T C C C C     A
      C A A        C      | | | | |     G
    G       T C T G       A G G G G     C
    G       + | | |                 T T
    T       G G A C
      T A          T     CAAT
                    C - G
                    A - T
                    G - C
                    G - C
                    A - T
                  T       T
                  T       A
                    T T C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK