The detailed information of tRNA gene sequence


Sequence ID>W131192944
Genome IDASNH01000031
Search identical group
Phylum/Classcandidate division KSB1
Speciescandidate division KSB1 bacterium SCGC AAA255-C20 [ASNH]
Start position on genome 20690
End posion on genome 20606
Amino Acid Tyr
Anticodon GTA
Upstream region at tRNA start position
tattttaaat
tRNA gene sequence
GGGGAGATACCCTAGTGGTCAAAGGGAGCAGACTGTAAATCTGCCGGCGAAGCCTTCGGA
GGTTCAAATCCTTCTCTCCCCACCA
Downstream region at tRNA end position
taacttgcgg
Secondary structure (Cloverleaf model)
>W131192944	Tyr	GTA
                   t      ACCA taacttgcgg
                     G - C
                     G - C
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T          T A
                    T     C T T C C     A
      T G A        A      | + | | |     A
    G       T C C C       G G A G G     C
    G       | | | |                 T T
    T       A G G G
      C A A        A     CGGCGAAGCCTTC
                    G - C
                    C - G
                    A - T
                    G - C
                    A - T
                  C       A
                  T       A
                    G T A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK