| Sequence ID | >W131193034 |
| Genome ID | ASNK01000049 |
| Phylum/Class | Unclassified |
| Species | Cloacimonetes bacterium SCGC AAA252-E20 KSB1 bacterium SCGC AAA252-E20 [ASNK] |
| Start position on genome | 1921 |
| End posion on genome | 1995 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
atctttttga |
| tRNA gene sequence |
GGCCCCATCGTCTAACGGTTAGGACTCAGGATTTTCATTCCTGCAATAGGGGTTCGATTC |
| Downstream region at tRNA end position |
tttgtggttt |
| Secondary structure (Cloverleaf model) | >W131193034 Glu TTC
a ACCA tttgtggttt
G - C
G + T
C - G
C - G
C - G
C - G
A - T T T
T T C C C C A
C A A C | | | | | G
G T C T G A G G G G C
G + | | | T T
T G G A C
T A T CAAT
C - G
A - T
G - C
G - C
A - T
T T
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |