The detailed information of tRNA gene sequence


Sequence ID>W131193037
Genome IDASNK01000113
Search identical group
Phylum/Classcandidate division KSB1
Speciescandidate division KSB1 bacterium SCGC AAA252-E20 [ASNK]
Start position on genome 471
End posion on genome 396
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
cgcaacacgt
tRNA gene sequence
GGGGCTATAGCTCAGTTGGGAGAGCATTTGTCTGGCAGACAAAGGGTCACGGGTTCGAGC
CCCGTTAGCTCCACCA
Downstream region at tRNA end position
gtcttcgctt
Secondary structure (Cloverleaf model)
>W131193037	Ala	GGC
                   t      ACCA gtcttcgctt
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     T - A
                     A - T          C G
                    T     T G C C C     A
      T G A        A      | | | | |     G
    T       C T C G       A C G G G     C
    G       | | | |                 T T
    G       G A G C
      G A          A     GGGTC
                    T - A
                    T - A
                    T - A
                    G - C
                    T - A
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK