The detailed information of tRNA gene sequence


Sequence ID>W131193102
Genome IDASNO01000001
Search identical group
Phylum/Classcandidate division KSB1
Speciescandidate division KSB1 bacterium SCGC AAA252-I16 [ASNO]
Start position on genome 75185
End posion on genome 75261
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
attcctttga
tRNA gene sequence
CGCGGGGTGGAGCAGTTTGGTAGCTCGTCAGGCTCATAACCTGAAGGTCGTAGGTTCAAA
TCCTGCCCCCGCTACCA
Downstream region at tRNA end position
ttttttgaat
Secondary structure (Cloverleaf model)
>W131193102	Met	CAT
                   a      ACCA ttttttgaat
                     C   T
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C G T C C     A
      T G A        G      | + | | |     A
    T       C G A G       G T A G G     C
    T       | | | |                 T T
    G       G C T C
      G T A        G     AGGTC
                    T - A
                    C - G
                    A - T
                    G - C
                    G - C
                  C       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK