The detailed information of tRNA gene sequence


Sequence ID>W131193136
Genome IDASNQ01000013
Search identical group
Phylum/Classcandidate division KSB1
Speciescandidate division KSB1 bacterium SCGC AAA252-K16 [ASNQ]
Start position on genome 20974
End posion on genome 21050
Amino Acid Val
Anticodon CAC
Upstream region at tRNA start position
aatttaggtc
tRNA gene sequence
GGGTGATTAGCTCAGCCGGTTAGAGCGCTACGTTCACATCGTAGAGGTCACTGGTTCGAA
TCCAGTATCACCCACCA
Downstream region at tRNA end position
tttttacaac
Secondary structure (Cloverleaf model)
>W131193136	Val	CAC
                   c      ACCA tttttacaac
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C
                     A - T
                     T - A          T A
                    T     T G A C C     A
      C G A        A      | | | | |     G
    C       C T C G       A C T G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    G - C
                  T       T
                  T       A
                    C A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK