The detailed information of tRNA gene sequence


Sequence ID>W131193151
Genome IDASNQ01000052
Search identical group
Phylum/Classcandidate division KSB1
Speciescandidate division KSB1 bacterium SCGC AAA252-K16 [ASNQ]
Start position on genome 1668
End posion on genome 1744
Amino Acid Ile
Anticodon GAT
Upstream region at tRNA start position
aatgtgaaaa
tRNA gene sequence
GGGCTTGTAGCTCAGTTGGTCAGAGCACCGCTCTGATAAGGCGGGGGTCGGTGGTTCGAG
TCCACCCAGGCCCACCA
Downstream region at tRNA end position
ttactgagcg
Secondary structure (Cloverleaf model)
>W131193151	Ile	GAT
                   a      ACCA ttactgagcg
                     G - C
                     G - C
                     G - C
                     C - G
                     T + G
                     T - A
                     G - C          T G
                    T     C C A C C     A
      T G A        A      | | | | |     G
    T       C T C G       G G T G G     C
    G       | | | |                 T T
    G       G A G C
      T C A        A     GGGTC
                    C - G
                    C - G
                    G - C
                    C - G
                    T + G
                  C       A
                  T       A
                    G A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK