The detailed information of tRNA gene sequence


Sequence ID>W131193183
Genome IDASNT01000007
Search identical group
Phylum/Classcandidate division KSB1
Speciescandidate division KSB1 bacterium SCGC AAA252-P10 [ASNT]
Start position on genome 432
End posion on genome 508
Amino Acid Gly
Anticodon TCC
Upstream region at tRNA start position
accataactt
tRNA gene sequence
GCGGGAATAGCTCAGCTGGCTAGAGCATTAGCCTTCCAAGCTAAGGGTCGCGGGTTCGAA
CCCCGTTTCCCGCTCCA
Downstream region at tRNA end position
tgctcgtgta
Secondary structure (Cloverleaf model)
>W131193183	Gly	TCC
                   t      TCCA tgctcgtgta
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     A - T
                     A - T          C A
                    T     T G C C C     A
      C G A        A      + | | | |     G
    T       C T C G       G C G G G     C
    G       | | | |                 T T
    G       G A G C
      C T A        A     GGGTC
                    T - A
                    T - A
                    A - T
                    G - C
                    C - G
                  C       A
                  T       A
                    T C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK