The detailed information of tRNA gene sequence


Sequence ID>W131193199
Genome IDASNT01000035
Search identical group
Phylum/Classcandidate division KSB1
Speciescandidate division KSB1 bacterium SCGC AAA252-P10 [ASNT]
Start position on genome 17073
End posion on genome 17147
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
tatagaaatg
tRNA gene sequence
TGGGTCGTCGCCAAGTGGCAAGGCACAGGGTTTTGGTCCCTGCATTCGGAGGTTCGAATC
CTCCCGACCCAGCCA
Downstream region at tRNA end position
tttttttaat
Secondary structure (Cloverleaf model)
>W131193199	Gln	TTG
                   g      GCCA tttttttaat
                     T - A
                     G - C
                     G - C
                     G - C
                     T - A
                     C - G
                     G - C          T A
                    T     C C T C C     A
        G A        C      | | | | |     G
      T     A C C G       G G A G G     C
      G       | | |                 T T
      G     A G G C
        C A        A     CATTC
                    C - G
                    A - T
                    G - C
                    G - C
                    G - C
                  T       T
                  T       G
                    T T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK