The detailed information of tRNA gene sequence


Sequence ID>W131193258
Genome IDASNW01000003
Search identical group
Phylum/Classcandidate division OD1
Speciescandidate division OD1 bacterium SCGC AB-164-E21 [ASNW]
Start position on genome 48427
End posion on genome 48354
Amino Acid Cys
Anticodon GCA
Upstream region at tRNA start position
cttaaaatag
tRNA gene sequence
GGCCAGGTAGCCAAGTGGCTAAGGCGTCGGTTTGCAAAACCGATATACACGGGTTCGACT
CCCGTCCTGGCCTCtt
Downstream region at tRNA end position
ccaatttttt
Secondary structure (Cloverleaf model)
>W131193258	Cys	GCA
                   g      TCtt ccaatttttt
                     G - C
                     G - C
                     C - G
                     C - G
                     A - T
                     G - C
                     G - C          T C
                    T     T G C C C     A
      T G A        A      | | | | |     G
    G       A C C G       A C G G G     C
    G         | | |                 T T
    C       A G G C
      T A          G     TATAC
                    T - A
                    C - G
                    G - C
                    G - C
                    T - A
                  T       A
                  T       A
                    G C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK