The detailed information of tRNA gene sequence


Sequence ID>W131193325
Genome IDASOB01000003
Search identical group
Phylum/Classcandidate division OP1
Speciescandidate division OP1 bacterium SCGC AAA255-C06 [ASOB]
Start position on genome 23377
End posion on genome 23304
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
accactaatt
tRNA gene sequence
GGGGCCTTAGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGCCAGGGGTTCGAGT
CCCCTAGGCTCCACag
Downstream region at tRNA end position
caaccctatc
Secondary structure (Cloverleaf model)
>W131193325	Ala	GGC
                   t      ACag caaccctatc
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     C - G
                     T - A          T G
                    T     T C C C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G G G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGCC
                    C - G
                    T - A
                    T - A
                    G - C
                    C - G
                  A       T
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK