The detailed information of tRNA gene sequence


Sequence ID>W131193328
Genome IDASOB01000011
Search identical group
Phylum/Classcandidate division OP1
Speciescandidate division OP1 bacterium SCGC AAA255-C06 [ASOB]
Start position on genome 2710
End posion on genome 2785
Amino Acid Glu
Anticodon TTC
Upstream region at tRNA start position
accgatgctt
tRNA gene sequence
GTCCCCATCATCTAGCGGCCTAGGATACCGGGTTTTCATCCCGGCGGCAGGGGTTCAAAT
CCCCTTGGGGACACAA
Downstream region at tRNA end position
gaaaagcccc
Secondary structure (Cloverleaf model)
>W131193328	Glu	TTC
                   t      ACAA gaaaagcccc
                     G - C
                     T - A
                     C - G
                     C - G
                     C - G
                     C - G
                     A - T          T A
                    T     T C C C C     A
      C G A        C      | | | | |     A
    G       T C T A       A G G G G     C
    G       + | | |                 T T
    C       G G A T
      C T A        A     CGGC
                    C - G
                    C - G
                    G - C
                    G - C
                    G - C
                  T       T
                  T       A
                    T T C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK