The detailed information of tRNA gene sequence


Sequence ID>W131193740
Genome IDASOY01000031
Search identical group
Phylum/Classcandidate division OP9
Speciescandidate division OP9 bacterium JGI 0000079-L04 [ASOY]
Start position on genome 49344
End posion on genome 49430
Amino Acid Leu
Anticodon CAG
Upstream region at tRNA start position
tcccttaaaa
tRNA gene sequence
GCCGAAGTGGCGGAACTGGTAGACGCGCTACGTTCAGGGCGTAGTAGGTGTATGCCTGTG
GGGGTTCAAATCCCCCCTTCGGCACCT
Downstream region at tRNA end position
ctcccgataa
Secondary structure (Cloverleaf model)
>W131193740	Leu	CAG
                   a      ACCT ctcccgataa
                     G - C
                     C - G
                     C - G
                     G - C
                     A - T
                     A - T
                     G - C          T A
                    T     C C C C C     A
      C A A        G      | | | | |     A
    T       G G C G       G G G G G     C
    G         | | |                 T T
    G       A C G C
      T A G        G     TAGGTGTATGCCTGT
                    C - G
                    T - A
                    A - T
                    C - G
                    G - C
                  T       G
                  T       G
                    C A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK