The detailed information of tRNA gene sequence


Sequence ID>W131193776
Genome IDASPA01000068
Search identical group
Phylum/Classcandidate division OP9
Speciescandidate division OP9 bacterium SCGC AAA255-G05 [ASPA]
Start position on genome 148
End posion on genome 62
Amino Acid Tyr
Anticodon GTA
Upstream region at tRNA start position
cgaaaataat
tRNA gene sequence
GGGGAGGTACCAAAGTGGTTAAATGGAGCGGACTGTAGATCCGCTGGCTGAACGCCTTCG
AAGGTTCGAATCCTTCCCTCCCCACCA
Downstream region at tRNA end position
ctttagttat
Secondary structure (Cloverleaf model)
>W131193776	Tyr	GTA
                   t      ACCA ctttagttat
                     G - C
                     G - C
                     G - C
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T T C C     A
      T G A        A      | | | | |     G
    G       A A C C       G A A G G     C
    G         | | |                 T T
    T       A T G G
      T A A        A     TGGCTGAACGCCTTC
                    G - C
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G
                    G T A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK