The detailed information of tRNA gene sequence


Sequence ID>W1711306901
Genome IDMANV01000128
Search identical group
Phylum/ClassDeltaproteobacteria
SpeciesDesulfobacterales bacterium C00003104 (MANV)
Start position on genome 4122
End posion on genome 4047
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
tccttaagaa
tRNA gene sequence
GGGCGGGTAGCTCAGTTGGGAGAGCATCGGCCTTACAAGCCGAGGGTCACAGGTTCAAGC
CCTGTTCCGCCTATCA
Downstream region at tRNA end position
taaaagaatc
Secondary structure (Cloverleaf model)
>W1711306901	Val	TAC
                   a      ATCA taaaagaatc
                     G + T
                     G - C
                     G - C
                     C - G
                     G - C
                     G - C
                     G + T          C G
                    T     T G T C C     A
      T G A        A      | | | | |     A
    T       C T C G       A C A G G     C
    G       | | | |                 T T
    G       G A G C
      G A          A     GGGTC
                    T - A
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    T A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK