The detailed information of tRNA gene sequence


Sequence ID>W1711315116
Genome IDMAVP01000029
Search identical group
Phylum/ClassDeltaproteobacteria
SpeciesDesulfobacterales bacterium S7086C20 (MAVP)
Start position on genome 17628
End posion on genome 17703
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
tgaatatcct
tRNA gene sequence
GGGCCCATAGCTCAGCTGGAAGAGCCACCGGCTCATAACCGGTAGGTCCCTGGTTCGAAC
CCAGGTGGGCCCACCA
Downstream region at tRNA end position
tctgtctttg
Secondary structure (Cloverleaf model)
>W1711315116	Met	CAT
                   t      ACCA tctgtctttg
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     A - T          C A
                    T     G G A C C     A
      C G A        A      | | | | |     G
    T       C T C G       C C T G G     C
    G       | | | |                 T T
    G       G A G C
      A A          C     AGGTC
                    A - T
                    C - G
                    C - G
                    G - C
                    G - C
                  C       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK