The detailed information of tRNA gene sequence


Sequence ID>W1711317546
Genome IDMAXJ01000299
Search identical group
Phylum/ClassDeltaproteobacteria
SpeciesDesulfobacterales bacterium S5133MH4 (MAXJ)
Start position on genome 5340
End posion on genome 5265
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
ataactgata
tRNA gene sequence
GGGCCCATAGCTCAGCTGGAAGAGCCACCGGCTCATAACCGGTAGGTCCCTGGTTCGAAC
CCAGGTGGGCCCACCA
Downstream region at tRNA end position
ctggaaaaag
Secondary structure (Cloverleaf model)
>W1711317546	Met	CAT
                   a      ACCA ctggaaaaag
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     A - T          C A
                    T     G G A C C     A
      C G A        A      | | | | |     G
    T       C T C G       C C T G G     C
    G       | | | |                 T T
    G       G A G C
      A A          C     AGGTC
                    A - T
                    C - G
                    C - G
                    G - C
                    G - C
                  C       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK