The detailed information of tRNA gene sequence


Sequence ID>W1711317564
Genome IDMAXK01000021
Search identical group
Phylum/ClassDeltaproteobacteria
SpeciesDesulfobulbaceae bacterium S5133MH15 (MAXK)
Start position on genome 2423
End posion on genome 2347
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
ttacaacatc
tRNA gene sequence
GGCGATGTAGCTCAGATGGTTAGAGCATACGGCTCATATCCGTAGTGTCCGGGGTTCAAT
TCCCTGCATCGCCACCA
Downstream region at tRNA end position
tagatacata
Secondary structure (Cloverleaf model)
>W1711317564	Met	CAT
                   c      ACCA tagatacata
                     G - C
                     G - C
                     C - G
                     G - C
                     A - T
                     T - A
                     G - C          T T
                    T     G T C C C     A
      A G A        A      | + | | |     A
    T       C T C G       C G G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        A     GTGTC
                    T - A
                    A - T
                    C - G
                    G - C
                    G - C
                  C       T
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK