The detailed information of tRNA gene sequence


Sequence ID>W1711317601
Genome IDMAXL01000053
Search identical group
Phylum/ClassDeltaproteobacteria
SpeciesDesulfobacterales bacterium S5133MH16 (MAXL)
Start position on genome 1184
End posion on genome 1110
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
ttttccacgc
tRNA gene sequence
GCGGGCATAACTCAGTGGTAGAGTACAAGCTTCCCAAGCTTGGAGTCGCGAGTTCAAATC
TCGTTGCCCGCTCCA
Downstream region at tRNA end position
ttggatattc
Secondary structure (Cloverleaf model)
>W1711317601	Gly	CCC
                   c      TCCA ttggatattc
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     C - G
                     A - T          T A
                    T     T G C T C     A
        G A        A      + | | | |     A
      T     C T C A       G C G A G     C
      G     | | | |                 T T
      G     G A G T
        T A        A     GAGTC
                    C - G
                    A - T
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK