The detailed information of tRNA gene sequence


Sequence ID>W1711317628
Genome IDMAXL01000525
Search identical group
Phylum/ClassDeltaproteobacteria
SpeciesDesulfobacterales bacterium S5133MH16 (MAXL)
Start position on genome 428
End posion on genome 353
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
caagggataa
tRNA gene sequence
GGGCGGGTAGCTCAGTTGGGAGAGCATCGGCCTTACAAGCCGAGGGTCACAGGTTCAAGC
CCTGTTCCGCCTACCA
Downstream region at tRNA end position
tttgggggtg
Secondary structure (Cloverleaf model)
>W1711317628	Val	TAC
                   a      ACCA tttgggggtg
                     G + T
                     G - C
                     G - C
                     C - G
                     G - C
                     G - C
                     G + T          C G
                    T     T G T C C     A
      T G A        A      | | | | |     A
    T       C T C G       A C A G G     C
    G       | | | |                 T T
    G       G A G C
      G A          A     GGGTC
                    T - A
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    T A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK