The detailed information of tRNA gene sequence


Sequence ID>W131235306
Genome IDAULM01000001
Search identical group
Phylum/ClassDeltaproteobacteria
SpeciesDesulfobacterium anilini DSM 4660 [AULM]
Start position on genome 226885
End posion on genome 226959
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
aatcatccgt
tRNA gene sequence
TGGGGTGTCGTCAAGCGGTAAGACACGGGCCTTTGGAGCCCGCATTCGGAGGTTCGAATC
CTCCCACCCCAGCCA
Downstream region at tRNA end position
ttttttatga
Secondary structure (Cloverleaf model)
>W131235306	Gln	TTG
                   t      GCCA ttttttatga
                     T - A
                     G - C
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T A
                    T     C C T C C     A
        G A        C      | | | | |     G
      C     A C T G       G G A G G     C
      G       | | |                 T T
      G     A G A C
        T A        A     CATTC
                    C - G
                    G - C
                    G - C
                    G - C
                    C - G
                  C       A
                  T       G
                    T T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK