The detailed information of tRNA gene sequence


Sequence ID>W1711377627
Genome IDMDZC01000044
Search identical group
Phylum/ClassBacteroidetes
SpeciesHymenobacter sp. CCM 8648 (MDZC)
Start position on genome 82330
End posion on genome 82402
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
tttgtagcct
tRNA gene sequence
GGCTGCGTAGTTCAAGGGATAGAATAGGCGTTTCCTAAACGCTTGATAGCAGTTCGAATC
TGCTCGTGGCTACtt
Downstream region at tRNA end position
aaaaggtcgt
Secondary structure (Cloverleaf model)
>W1711377627	Arg	CCT
                   t      ACtt aaaaggtcgt
                     G + T
                     G - C
                     C - G
                     T + G
                     G + T
                     C - G
                     G - C          T A
                    T     T C G T C     A
      G A A        A      | | | | |     G
    G       C T T G       A G C A G     C
    G       | | | +                 T T
    A       G A A T
      T A          A     TGAT
                    G + T
                    G - C
                    C - G
                    G - C
                    T - A
                  T       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK