The detailed information of tRNA gene sequence


Sequence ID>W1711391321
Genome IDMELJ01000241
Search identical group
Phylum/ClassActinobacteria
SpeciesActinobacteria bacterium RBG_13_35_12 (MELJ)
Start position on genome 4299
End posion on genome 4224
Amino Acid Thr
Anticodon CGT
Upstream region at tRNA start position
caattgcatt
tRNA gene sequence
GCCGATGTAGCTCAACTGGTAGAGCAGCTCATTCGTAATGAGCAGGTTATCGGTTCAAGT
CCGGTCATCGGCTCCA
Downstream region at tRNA end position
gtgaaagaga
Secondary structure (Cloverleaf model)
>W1711391321	Thr	CGT
                   t      TCCA gtgaaagaga
                     G - C
                     C - G
                     C - G
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     T G G C C     A
      C A A        A      | + | | |     A
    T       C T C G       A T C G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     AGGTT
                    G - C
                    C - G
                    T - A
                    C - G
                    A - T
                  T       A
                  T       A
                    C G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK