The detailed information of tRNA gene sequence


Sequence ID>W1711398133
Genome IDMEYG01000015
Search identical group
Phylum/ClassCandidatusAtribacteria
SpeciesCandidatus Atribacteria bacterium RBG_16_35_8 (MEYG)
Start position on genome 4130
End posion on genome 4206
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
tgttaattta
tRNA gene sequence
GGCGGTGTAGCTCAGATGGCTAGAGCATGCGGTTCATACCCGCAGTGTCCTGAGTTCGAA
TCTCAGCACCGCCACCA
Downstream region at tRNA end position
aaaatattta
Secondary structure (Cloverleaf model)
>W1711398133	Met	CAT
                   a      ACCA aaaatattta
                     G - C
                     G - C
                     C - G
                     G - C
                     G - C
                     T - A
                     G - C          T A
                    T     G A C T C     A
      A G A        A      | | | | |     G
    T       C T C G       C T G A G     C
    G       | | | |                 T T
    G       G A G C
      C T A        A     GTGTC
                    T - A
                    G - C
                    C - G
                    G - C
                    G - C
                  T       C
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK